File Coverage

Bio/SeqFeature/Primer.pm

Criterion	Covered	Total	%
statement	65	66	98.4
branch	13	14	92.8
condition			n/a
subroutine	8	8	100.0
pod	4	4	100.0
total	90	92	97.8

#
# BioPerl module for Bio::SeqFeature::Primer
#
# This is the original copyright statement. I have relied on Chad's module
# extensively for this module.
#
# Copyright (c) 1997-2001 bioperl, Chad Matsalla. All Rights Reserved.
#           This module is free software; you can redistribute it and/or
#           modify it under the same terms as Perl itself.
#
# Copyright Chad Matsalla
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
#
# But I have modified lots of it, so I guess I should add:
#
# Copyright (c) 2003 bioperl, Rob Edwards. All Rights Reserved.
#           This module is free software; you can redistribute it and/or
#           modify it under the same terms as Perl itself.
#
# Copyright Rob Edwards
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code

=head1 NAME

Bio::SeqFeature::Primer - Primer Generic SeqFeature

=head1 SYNOPSIS

  use Bio::SeqFeature::Primer;

  # Primer object with explicitly-defined sequence object or sequence string
  my $primer = Bio::SeqFeature::Primer->new( -seq => 'ACGTAGCT' );
  $primer->display_name('test_id');
  print "These are the details of the primer:\n".
        "Name:     ".$primer->display_name."\n".
        "Tag:      ".$primer->primary_tag."\n".   # always 'Primer'
        "Sequence: ".$primer->seq->seq."\n".
        "Tm:       ".$primer->Tm."\n\n";            # melting temperature

  # Primer object with implicit sequence object
  # It is a lighter approach for when the primer location on a template is known
  use Bio::Seq;
  my $template = Bio::Seq->new( -seq => 'ACGTAGCTCTTTTCATTCTGACTGCAACG' );
  $primer   = Bio::SeqFeature::Primer->new( -start => 1, -end =>5, -strand => 1 );
  $template->add_SeqFeature($primer);
  print "Primer sequence is: ".$primer->seq->seq."\n";
  # Primer sequence is 'ACGTA'

=head1 DESCRIPTION

This module handles PCR primer sequences. The L object
is a L object that can additionally contain a primer
sequence and its coordinates on a template sequence. The primary_tag() for this
object is 'Primer'. A method is provided to calculate the melting temperature Tm
of the primer. L objects are useful to build
L amplicon objects such as the ones returned by
L.

=head1 FEEDBACK

=head2 Mailing Lists

User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists.  Your participation is much appreciated.

  [e-mail]                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

=head2 Support

Please direct usage questions or support issues to the mailing list:

I

rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.

=head2 Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution.  Bug reports can be submitted via the
web:

  https://github.com/bioperl/bioperl-live/issues

=head1 AUTHOR

Rob Edwards, [e-mail]

The original concept and much of the code was written by
Chad Matsalla, [e-mail]

=head1 APPENDIX

The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _

=cut


package Bio::SeqFeature::Primer;

use strict;
use Bio::PrimarySeq;
use Bio::Tools::SeqStats;

use base qw(Bio::SeqFeature::SubSeq);


=head2 new()

 Title   : new()
 Usage   : my $primer = Bio::SeqFeature::Primer( -seq => $seq_object );
 Function: Instantiate a new Bio::SeqFeature::Primer object
 Returns : A Bio::SeqFeature::Primer object
 Args    : -seq , a sequence object or a sequence string (optional)
           -id  , the ID to give to the primer sequence, not feature (optional)

=cut

sub new {
    my ($class, %args) = @_;

    # Legacy stuff
    my $sequence = delete $args{-sequence};
    if ($sequence) {
        Bio::Root::Root->deprecated(
            -message => 'Creating a Bio::SeqFeature::Primer with -sequence is deprecated. Use -seq instead.',
            -warn_version  => '1.006',
            -throw_version => '1.008',
        );
        $args{-seq} = $sequence;
    }

    # Initialize Primer object
    my $self = $class->SUPER::new(%args);
    my ($id) = $self->_rearrange([qw(ID)], %args);
    $id && $self->seq->id($id);
    $self->primary_tag('Primer');
    return $self;
}


# Bypass B::SF::Generic's location() when a string is passed (for compatibility)

sub location {
    my ($self, $location) = @_;
    if ($location) {
        if ( not ref $location ) {
            # Use location as a string for backward compatibility
            Bio::Root::Root->deprecated(
                -message => 'Passing a string to location() is deprecated. Pass a Bio::Location::Simple object or use start() and end() instead.',
                -warn_version  => '1.006',
                -throw_version => '1.008',
            );
            $self->{'_location'} = $location;
        } else {
            $self->SUPER::location($location);
        }
    }
    return $self->SUPER::location;
}


=head2 Tm()

 Title   : Tm()
 Usage   : my $tm = $primer->Tm(-salt => 0.05, -oligo => 0.0000001);
 Function: Calculate the Tm (melting temperature) of the primer
 Returns : A scalar containing the Tm.
 Args    : -salt  : set the Na+ concentration on which to base the calculation
                    (default=0.05 molar).
         : -oligo : set the oligo concentration on which to base the
                    calculation (default=0.00000025 molar).
 Notes   : Calculation of Tm as per Allawi et. al Biochemistry 1997
           36:10581-10594. Also see documentation at
           http://www.idtdna.com/Scitools/Scitools.aspx as they use this
           formula and have a couple nice help pages. These Tm values will be
           about are about 0.5-3 degrees off from those of the idtdna web tool.
           I don't know why.

           This was suggested by Barry Moore (thanks!). See the discussion on
           the bioperl-l with the subject "Bio::SeqFeature::Primer Calculating
           the PrimerTM"

=cut

sub Tm {
    my ($self, %args) = @_;
    my $salt_conc = 0.05; # salt concentration (molar units)
    my $oligo_conc = 0.00000025; # oligo concentration (molar units)
    if ($args{'-salt'}) {
        # Accept object defined salt concentration
        $salt_conc = $args{'-salt'};
    }
    if ($args{'-oligo'}) {
        # Accept object defined oligo concentration
        $oligo_conc = $args{'-oligo'};
    }
    my $seqobj = $self->seq();
    my $length = $seqobj->length();
    my $sequence = uc $seqobj->seq();
    my @dinucleotides;
    my $enthalpy;
    my $entropy;
    # Break sequence string into an array of all possible dinucleotides
    while ($sequence =~ /(.)(?=(.))/g) {
        push @dinucleotides, $1.$2;
    }
    # Build a hash with the thermodynamic values
    my %thermo_values = ('AA' => {'enthalpy' => -7.9,
                                  'entropy'  => -22.2},
                         'AC' => {'enthalpy' => -8.4,
                                  'entropy'  => -22.4},
                         'AG' => {'enthalpy' => -7.8,
                                  'entropy'  => -21},
                         'AT' => {'enthalpy' => -7.2,
                                  'entropy'  => -20.4},
                         'CA' => {'enthalpy' => -8.5,
                                  'entropy'  => -22.7},
                         'CC' => {'enthalpy' => -8,
                                  'entropy'  => -19.9},
                         'CG' => {'enthalpy' => -10.6,
                                  'entropy'  => -27.2},
                         'CT' => {'enthalpy' => -7.8,
                                  'entropy'  => -21},
                         'GA' => {'enthalpy' => -8.2,
                                  'entropy'  => -22.2},
                         'GC' => {'enthalpy' => -9.8,
                                  'entropy'  => -24.4},
                         'GG' => {'enthalpy' => -8,
                                  'entropy'  => -19.9},
                         'GT' => {'enthalpy' => -8.4,
                                  'entropy'  => -22.4},
                         'TA' => {'enthalpy' => -7.2,
                                  'entropy'  => -21.3},
                         'TC' => {'enthalpy' => -8.2,
                                  'entropy'  => -22.2},
                         'TG' => {'enthalpy' => -8.5,
                                  'entropy'  => -22.7},
                         'TT' => {'enthalpy' => -7.9,
                                  'entropy'  => -22.2},
                         'A' =>  {'enthalpy' => 2.3,
                                  'entropy'  => 4.1},
                         'C' =>  {'enthalpy' => 0.1,
                                  'entropy'  => -2.8},
                         'G' =>  {'enthalpy' => 0.1,
                                  'entropy'  => -2.8},
                         'T' =>  {'enthalpy' => 2.3,
                                  'entropy'  => 4.1}
                        );
    # Loop through dinucleotides and calculate cumulative enthalpy and entropy values
    for (@dinucleotides) {
        $enthalpy += $thermo_values{$_}{enthalpy};
        $entropy += $thermo_values{$_}{entropy};
    }
    # Account for initiation parameters
    $enthalpy += $thermo_values{substr($sequence,  0, 1)}{enthalpy};
    $entropy  += $thermo_values{substr($sequence,  0, 1)}{entropy};
    $enthalpy += $thermo_values{substr($sequence, -1, 1)}{enthalpy};
    $entropy  += $thermo_values{substr($sequence, -1, 1)}{entropy};
    # Symmetry correction
    $entropy -= 1.4;
    my $r = 1.987; # molar gas constant
    my $tm = $enthalpy * 1000 / ($entropy + ($r * log($oligo_conc))) - 273.15 + (12* (log($salt_conc)/log(10)));

    return $tm;
 }

=head2 Tm_estimate

 Title   : Tm_estimate
 Usage   : my $tm = $primer->Tm_estimate(-salt => 0.05);
 Function: Estimate the Tm (melting temperature) of the primer
 Returns : A scalar containing the Tm.
 Args    : -salt set the Na+ concentration on which to base the calculation.
 Notes   : This is only an estimate of the Tm that is kept in for comparative
           reasons. You should probably use Tm instead!

           This Tm calculations are taken from the Primer3 docs: They are
           based on Bolton and McCarthy, PNAS 84:1390 (1962)
           as presented in Sambrook, Fritsch and Maniatis,
           Molecular Cloning, p 11.46 (1989, CSHL Press).

           Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length

           where [Na+] is the molar sodium concentration, %GC is the
           %G+C of the sequence, and length is the length of the sequence.

           However.... I can never get this calculation to give me the same result
           as primer3 does. Don't ask why, I never figured it out. But I did
           want to include a Tm calculation here because I use these modules for
           other things besides reading primer3 output.

           The primer3 calculation is saved as 'PRIMER_LEFT_TM' or 'PRIMER_RIGHT_TM'
           and this calculation is saved as $primer->Tm so you can get both and
           average them!

=cut

sub Tm_estimate {

    # This should probably be put into seqstats as it is more generic, but what the heck.

    my ($self, %args) = @_;
    my $salt = 0.2;
    if ($args{'-salt'}) {
        $salt = $args{'-salt'}
    };
    my $seqobj = $self->seq();
    my $length = $seqobj->length();
    my $seqdata = Bio::Tools::SeqStats->count_monomers($seqobj);
    my $gc=$$seqdata{'G'} + $$seqdata{'C'};
    my $percent_gc = ($gc/$length)*100;

    my $tm = 81.5+(16.6*(log($salt)/log(10)))+(0.41*$percent_gc) - (600/$length);

    return $tm;
}

=head2 primary_tag, source_tag, location, start, end, strand...

The documentation of L describes all the methods that
L object inherit.

=cut

1;